✔ https://StudyForce.com
✔ https://Biology-Forums.com
✔ Ask questions here: https://Biology-Forums.com/index.php?board=33.0
Follow us:
▶ Facebook: https://facebook.com/StudyForcePS/
▶ Instagram: https://instagram.com/biologyforums/
▶ Twitter: https://twitter.com/studyforceps
Q. Assume you are using PCR to make multiple copies of a gene (shaded in below).
DNA containing gene of interest:
3' TATAAAGACTTACAAATTTGTCCCCATTTTGC 5'
5' ATATTTCTGAATGTTTAAACAGGGGTAAAACG 3'
Describe the overall process and diagram the results you would obtain for 1, 2 and 3 rounds of PCR replication using the primers,
ATGTT and CCATT.
STEP 1: Heat the DNA to 95 °C
STEP 2: Lower the temperature between 45 to 60 °C and apply the primers.
STEP 3: Allow the primers to anneal (stick) to the single strands.
STEP 4: The Taq Polymerase adds dNTPs to the open 3' end of the DNA primers
PCR proceeds in a series of cycles, or rounds. Each successive round doubles the amount of DNA and thus more than 1 billion copies of a single DNA fragment can be made in just a few hours. The technique of PCR is simple enough to be used by scientists with little training in molecular biology. The supplies necessary for carrying out PCR are available in a kit form that is used in such varied settings as crime laboratories and clinical diagnostic laboratories.